Oligonucleotides
Invitrogen™ Oligo(dT) 12-18 Primer
Primer is suitable for use in first-strand cDNA synthesis with reverse transcriptase Oligo(dT)12 18 Primer, 25 µg
Thermo Scientific™ Oligo(dT)18 Primers
Thermo Scientific™ Oligo(dT)18 Primer is a synthetic single-stranded 18-mer oligonucleotide with 5'- and 3'-hydroxyl ends. 60 UL OLIGO(DT)18 PRIMER, 100µM 60µL STORE AT-20°C
Applied Biosystems™ Oligo d(T) 16 (50mM)
Used for priming and reverse transcription of polyadenylated (poly A+) mRNA OLIGO D(T)16 PRIMERApplied Biosystems® Oligo d(T)16 is a
Invitrogen™ Bio-11-UTP (75mM)
Ideal for use as substrates as part of in vitro transcription reactions 30 UL BIO-11-UTP 30µL STORE AT -80°C
Thermo Scientific™ Transcription Promoter Sequencing Primers
Perform sequencing of DNA fragments located downstream from the corresponding RNA polymerase promoter sequences in cloning vectors, such as pTZ19R, pTZ57R and pBluescript II. T3 PRIMER 17-MER 10UM 6NMOL
Invitrogen™ Oligo(dT) 20 Primer
Used for first-strand cDNA synthesis with reverse transcriptase at temperatures of ≥50°C OLIGO DT(20) PRIMER
Thermo Scientific™ Transcription Promoter Sequencing Primers
Perform sequencing of DNA fragments located downstream from the corresponding RNA polymerase promoter sequences in cloning vectors, such as pTZ19R, pTZ57R and pBluescript II. T3 PRIMER 24-MER 10UM 4.2NMOL
Invitrogen™ Random Primers
Truly random primers suitable for DNA synthesis using Klenow fragments with DNA templates or for cDNA synthesis using reverse transcriptase with mRNA templates RANDOM PRIMERS,1.5MM 9 units
Invitrogen™ T7 Promoter Primer
Primers for PCR amplification that complement many vectors PRIMER, T7Invitrogen offers primers for PCR amplification
Invitrogen™ pUC19 DNA (Sau3A I digested)
Ambion pUC 19 DNA is digested to completion with Sau3A I 0.5 MG PUC19 DNA - SAU3A I DIGESTED 0.5MG STOREat -20 C
Thermo Scientific™ M13/pUC sequencing primer (-20), 17-mer
Accurately sequence DNA with M13 pUC sequencing primers, single-stranded oligonucleotides with 5'-hydroxyl and 3'-hydroxyl ends. 6 NMOL M13/PUC SEQUENCING PRIMER (-20), 17-MER,5'-d(GTAAAACGACGGCCAGT)-3', 10µm, 6nmol Store at
Thermo Scientific™ M13/pUC reverse sequencing primer (-46), 24-mer
Sequence DNA fragments inserted into the MCS of various pUC19 based cloning vectors with M13 pUC sequencing primers, single-stranded oligonucleotides. M13/PUC REV -46 10UM 4.2NMOL
Invitrogen™ M13 Reverse
Oligonucleotides complementary to a DNA template are necessary to prime DNA synthesis for sequencing reactions 2UG PRIM,M13 REVERSE
Thermo Scientific™ M13/pUC sequencing primer (-40), 17-mer
Sequence DNA fragments inserted into the MCS of various pUC19 based cloning vectors with M13 pUC sequencing primers, single-stranded oligonucleotides. 6 NMOL M13/PUC SEQUENCING PRIMER (-40), 17-MER,5'-d(GTTTTCCCAGTCACGAC)-3', 10µm, 6nmol Store at
Invitrogen™ Bio-16-UTP (10mM)
Ideal for use as substrates as part of in vitro transcription reactions 25 UL BIO-16-UTP 25µL STORE AT -80°C
Thermo Scientific™ Transcription Promoter Sequencing Primers
Perform sequencing of DNA fragments located downstream from the corresponding RNA polymerase promoter sequences in cloning vectors, such as pTZ19R, pTZ57R and pBluescript II. SP6 PRIM 18-MER 10UM 5.6 NMOL
Invitrogen™ Random Decamers (50μM)
Provided at a stock concentration of 50μM, and functionally tested using the RETROscript™ Kit 80 UL RANDOM DECAMERS (50 UM) 80µL STORE AT -20 C
Thermo Scientific™ Transcription Promoter Sequencing Primers
Perform sequencing of DNA fragments located downstream from the corresponding RNA polymerase promoter sequences in cloning vectors, such as pTZ19R, pTZ57R and pBluescript II. T7 PRIMER 20-MER 10UM 5NMOL
Invitrogen™ Anchored Oligo(dT) 20 Primer
Primer mixture consisting of a string of 20 deoxythymidylic acid residues followed by dV (either dG, dA, or dC) and then by dN (dA, dT, dG, or dC) ANCHORED OLIGO(DT) 20 PRIM50UG
Applied Biosystems™ Random Hexamers (50mM)
Serve as primers for DNA synthesis by a DNA polymerase or reverse transcriptase 1 SET Random Hexamers (50um) 1kit Store at -20 C
Invitrogen™ Oligo (dT) Primer (50mM)
Provided at a stock concentration of 50μM 80 UL OLIGO (DT) PRIMER (50 UM) 80µL STORE AT-20°C
Invitrogen™ 5-(3-Aminoallyl)-dUTP (50mM)
When incorporated into DNA, 5-(3-aminoallyl)-dUTP provides a reactive group for addition of other chemical groups 50MM 5-(3-AMINOALLYL)-UTP 5ULAmbion® Modified nucleotides confer unique
Applied Biosystems™ 5' Fluorescent Labeled Single Primers
Custom 5' labeled primers are fluorescently labeled oligos with a choice of dye on the 5' end TA PCRII DUAL PROMOTER
Thermo Scientific™ M13/pUC sequencing primer (-46), 22-mer
Sequence DNA fragments inserted into the MCS of various pUC19 based cloning vectors with M13 pUC sequencing primers, single-stranded oligonucleotides. M13/PUC PRIM -46 10UM 4.5NMOL
Invitrogen™ M13 Forward (-20)
Oligonucleotides complementary to a DNA template are necessary to prime DNA synthesis for sequencing reactions 2UG PRIM,M13(-20)FORWARD
Invitrogen™ 5-(3-Aminoallyl)-UTP (50mM)
Ambion Modified nucleotides confer unique characteristics to the RNA molecules into which they are incorporated 50MM 5-(3-AMINOALLYL)-UTP 50ULAmbion® Modified nucleotides confer unique
Invitrogen™ RNA Century™-Plus Marker Templates
Contain mixtures of linearized plasmids ready for use as templates during in vitro transcription reactions for synthesis of labeled RNA molecular size standards 5 UG CENTURY-PLUS MARKER TEMPLATES 5µG STORE AT-20 C
Thermo Scientific™ pJET1.2 Sequencing Primers
Primers for sequencing of DNA fragments inserted into Eco32I site within the eco47IR gene of pJET1.2 and for colony screening by PCR. PJET1.2 FORWARD SEQUENCING PRIMER, 23-MER, 5'-D(CGACTCACTATAGGGAGAGCGGC)-3, 10µm, 8.7nmol Store at
Thermo Scientific™ Transcription Promoter Sequencing Primers
Perform sequencing of DNA fragments located downstream from the corresponding RNA polymerase promoter sequences in cloning vectors, such as pTZ19R, pTZ57R and pBluescript II. SP6 PRIM 24-MER 10UM 4.2NMOL
Invitrogen™ Bio-11-UTP (10mM)
Ideal for use as substrates as part of in vitro transcription reactions 25 UL BIO-11-UTP 25µL STORE AT -80°C